Antibody-Antibodies

Product

LYAR cloning plasmid

Supplier Cusabio · Catalog number: CSB-CL882130HU-10ug

Price

233.00 EUR

Size
10ug

A cloning plasmid for the LYAR gene.

  • Additional information:

      • Formulation: 10 μg plasmid + 200μl Glycerol
      • Length: 1140
      • Sequence: atggtattttttacatgcaatgcatgtggtgaatcagtgaagaaaatacaagtggaaaagcatgtgtctgtttgcagaaactgtgaatgcctttcttgcattgactgcggtaaagatttctggggcgatgactataaaaaccacgtgaaatgcataagtgaagatcagaagtatg
    • Show more
  • Storage and shipping:Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes:For research use only.

* The price of the product is approximate, please contact us for price confirmation

Related Products:

20-abx988403
Rat LYAR shRNA Plasmid
Abbexa
  • 0
  • 1
20-abx971393
Mouse LYAR shRNA Plasmid
Abbexa
  • 0
  • 1
PAPOLA cloning plasmid
CSB-CL017432HU-10ug
Cusabio 10ug
PARK2 cloning plasmid
CSB-CL017451HU-10ug
Cusabio 10ug
PDLIM4 cloning plasmid
CSB-CL017735HU1-10ug
Cusabio 10ug

Do you have a question? Do you want to order?
Contact us.

Exit mobile version