* The price of the product is approximate, please contact us for price confirmation

CRBN cloning plasmid

Supplier Cusabio · Catalog number: CSB-CL842761HU2-10ug

Price

233.00 EUR

Size
10ug

A cloning plasmid for the CRBN gene.

  • Additional information:

      • Formulation: 10 μg plasmid + 200μl Glycerol
      • Length: 1326
      • Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacatacc
    • Show more
  • Storage and shipping:Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes:For research use only.

What is the differences between Virus and Bacteria

What is the differences between Virus and Bacteria?

The microbial species are found naturally in the environment. The bacteria community competes for space and resources with other species and studies reveal that with mixed or pure cultures, bacteria can kill or impair other microbes for survival and can impact the outcome of competition in nature. Bacteria are the simplest and most abundant living…
are the scooter sharing is safe danger from xiaomi ninebot woman scaning code

Is the scooter sharing safe? (Danger from Xiaomi, Ninebot…)

Scooter sharing is the temporary rental of scooters as a last-mile and for a short distance. The scooter-sharing companies such as Bird, Spin, and Bolt provide a new experience for urban transport that has a low barrier for entry. A scooter (Xiaomi, Ninebot and other) sharing system helps to reduce traffic, car trips and carbon…
Measles Virus Detection side view female looking through microscope

PCR Kit to Measles Virus Detection

Measles is caused by measles virus which is single-stranded, negative sense enveloped RNA virus. It is well known to be highly contagious. It’s airborne but is spread also via direct contact with secretions. The only host of this virus is human. Each year it infects 20-40 million people around the world, one to two millions…

Related Products:

CRBN cloning plasmid
CSB-CL842761HU2-10ug
Cusabio 10ug
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN
ImmunoStep 50 µg
PLDN cloning plasmid
CSB-CL890745HU-10ug
Cusabio 10ug
ZDHHC8 cloning plasmid
CSB-CL890747HU-10ug
Cusabio 10ug
PPIE cloning plasmid
CSB-CL890944HU-10ug
Cusabio 10ug

Do you have a question? Do you want to order?
Contact us.