Image of COTL1 cloning plasmid

COTL1 cloning plasmid

Supplier Cusabio · Catalog number: CSB-CL622751HU2-10ug


233.00 EUR

  • Gene name: COTL1
  • Gene ID: 23406
  • Accession number: BC042970
  • Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
For research use only.
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atggcgaccaagatcgacaaagaggcttgccgggcggcgtacaacctggtgcgcgacgacggctcggccgtcatctgggtgacttttaaatatgacggctccaccatcgtccacggcgagcagggagcggagtaccagcacttcatccagcagtgcacagatgacgtcaggttgtttgccttcgtgcgcttcaccaccggggatgccatgagcaagaggtccaagtttgccctcatcacgtggatcggtgagaacgtcagcgggctgcagcgcgccaaaaccgggacggacaagaccctggtgaaggaggtcgtacagaatttcgctaaggagtttgtgatcagtgatcggaaggagctggaggaagatttcatcaagagcgagctgaagaaggcggggggagccaattacgacgcccagacggagtaa
Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.

* The price of the product is approximate, please contact us for price confirmation

Related Products:

COTL1 cloning plasmid
Cusabio 10ug
Human Coactosin Like Protein 1 (COTL1) ELISA Kit
DL Develop 48T
STAP1 cloning plasmid
Cusabio 10ug
PADI4 cloning plasmid
Cusabio 10ug
ZFP112 cloning plasmid
Cusabio 10ug

Do you have a question? Do you want to order?
Contact us.