RSBN1 cloning plasmid

Supplier Cusabio · Catalog number: CSB-CL020537HU-10ug

 (0) Reviews
Price

279.60 EUR

Size
10ug
A cloning plasmid for the RSBN1 gene.
  • Specifications:
    • Gene name: RSBN1
    • Gene ID: 54665
    • Accession number: BC026155
    • Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Storage and shipping:Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes:For research use only.
  • Additional informations:
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1236
    • Sequence: atggctgcgcaggtcggagcggtgcgcgtagtacgggcggtggcggcgcaggaggagccggacaaagaggggaaggagaaacctcatgctggggtctccccgcggggagttaaacggcagcgccgatctagcagtggggggtctcaggagaagcgggggcggccgagccaggagccccctctcgctccccctcaccggcggcgtcgcagccgccaacatcctgggccgctgccgccaacgaatgcagccccaactgtcccaggccctgttgagcctcttctcctgccgcctccgccgccaccttcgctggcacccgccgggcccgctgtcgctgcccctctcccggccccaagcacctcggccctcttcaccttctcgcctctgacggtgagcgcggccgggcccaagcataagggccacaaggagcggcacaagcaccatcaccaccgcggccccgatggtgatcccagctcctgcggaaccgatctcaagcacaaggacaagcaggaaaacggcgagaggactggaggggtgcctctgatcaaagcccccaagagagaaacaccagatgaaaatggtaaaacccagagagccgatgattttgtcttgaagaaaataaagaagaaaaagaaaaagaaacaccgagaagacatgcgaggaagacgccttaaaatgtacaataaggaagtacaaaccgtctgtgctggcctgacccgcatcagtaaagaaattctcacccaaggacaaataaatagcacttcaggacttaataaggagtccttcaggtatctgaaagatgaacagctgtgccgattaaatttgggtatgcaagaatatcgggtaccccagggagtacaaacaccttttatgactcaccaggaacattctattcgtagaaatttcttaaaaacaggtactaaatttagcaactttattcatgaggaacaccagtccaatggtggtgctcttgtccttcatgcttacatggatgaactctcatttttgtctccaatggagatggagagattttctgaggagtttcttgctttgacattcagtgaaaatgagaaaaatgctgcttactatgctttagcaatagtgcatggagcggctgcttatctcccagacttcttggactactttgcttttaatttccccaacactccagtgaaaatggaaattctgggcaagaaagatattgaaacaaccaccatttcaaattttcacactcagtag

* The price of the product is approximate, please contact us for price confirmation

Related Products:

Human RSBN1 shRNA Plasmid
20-abx960169
Abbexa
  • 150 µg
  • 300 µg
Mouse RSBN1 shRNA Plasmid
20-abx981723
Abbexa
  • 150 µg
  • 300 µg
GINS4 cloning plasmid
CSB-CL871563HU-10ug
Cusabio 10ug
SLC39A3 cloning plasmid
CSB-CL871564HU-10ug
Cusabio 10ug
NLRP1 cloning plasmid
CSB-CL871630HU-10ug
Cusabio 10ug

Do you have a question? Do you want to order?
Contact us.