Image of IGKV1-5 cloning plasmid

IGKV1-5 cloning plasmid

Supplier Cusabio · Catalog number: CSB-CL011359HU2-10ug

Price

279.60 EUR

Size
10ug
Description
  • Gene name: IGKV1-5
  • Gene ID: 28299
  • Accession number: BC034146
  • Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
For research use only.
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atggacatgagggtccccgctcagctcctggggctcctgctgctctggctcccaggagccaaatgtgacatccagatgacccagtctccttccaccctgtctgcatctgtcggcgacagagtcaccatcgcttgccgggccagccagtggattagtgattggttggcctggtatcagcagaaaccagggaaggcccctaaactcctgatctatgatgcctccagattggaaagtggggtcccatcaaggttcagcggcagtggatctgggacagaatttagtctcaccattagtggcctgcagcctgatgattttgctacttattactgccaaccatacaattccaattctccccaattcggccaagggaccaaggtggaaatcaaacgaactgtggctgcaccatctgtcttcatcttcccgccatctgatgagcagttgaaatctggaactgcctctgttgtgtgcctgctgaataacttctatcccagagaggccaaagtacagtggaaggtggataacgccctccaatcgggtaactcccaggagagtgtcacagagcaggacagcaaggacagcacctacagcctcagcagcaccctgacgctgagcaaagcagactacgagaaacacaaagtctacgcctgcgaagtcacccatcagggcctgagctcgcccgtcacaaagagcttcaacaggggagagtgttag
Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.

* The price of the product is approximate, please contact us for price confirmation

Related Products:

IGKV1-5 cloning plasmid
CSB-CL011359HU1-10ug
Cusabio 10ug
IGKV1-5 cloning plasmid
CSB-CL011359HU3-10ug
Cusabio 10ug
CLEC2D cloning plasmid
CSB-CL883401HU-10ug
Cusabio 10ug
CYB5R1 cloning plasmid
CSB-CL883402HU-10ug
Cusabio 10ug
CBWD1 cloning plasmid
CSB-CL883588HU3-10ug
Cusabio 10ug

Do you have a question? Do you want to order?
Contact us.