Image of IGKV1-5 cloning plasmid

IGKV1-5 cloning plasmid

Supplier Cusabio · Catalog number: CSB-CL011359HU2-10ug


233.00 EUR

  • Gene name: IGKV1-5
  • Gene ID: 28299
  • Accession number: BC034146
  • Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
For research use only.
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atggacatgagggtccccgctcagctcctggggctcctgctgctctggctcccaggagccaaatgtgacatccagatgacccagtctccttccaccctgtctgcatctgtcggcgacagagtcaccatcgcttgccgggccagccagtggattagtgattggttggcctggtatcagcagaaaccagggaaggcccctaaactcctgatctatgatgcctccagattggaaagtggggtcccatcaaggttcagcggcagtggatctgggacagaatttagtctcaccattagtggcctgcagcctgatgattttgctacttattactgccaaccatacaattccaattctccccaattcggccaagggaccaaggtggaaatcaaacgaactgtggctgcaccatctgtcttcatcttcccgccatctgatgagcagttgaaatctggaactgcctctgttgtgtgcctgctgaataacttctatcccagagaggccaaagtacagtggaaggtggataacgccctccaatcgggtaactcccaggagagtgtcacagagcaggacagcaaggacagcacctacagcctcagcagcaccctgacgctgagcaaagcagactacgagaaacacaaagtctacgcctgcgaagtcacccatcagggcctgagctcgcccgtcacaaagagcttcaacaggggagagtgttag
Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.

* The price of the product is approximate, please contact us for price confirmation

Related Products:

IGKV1-5 cloning plasmid
Cusabio 10ug
IGKV1-5 cloning plasmid
Cusabio 10ug
ITPK1 cloning plasmid
Cusabio 10ug
SEMA5A cloning plasmid
Cusabio 10ug
PON2 cloning plasmid
Cusabio 10ug

Do you have a question? Do you want to order?
Contact us.