Image of FGG cloning plasmid

FGG cloning plasmid

Supplier Cusabio · Catalog number: CSB-CL008651HU-10ug

Price

233.00 EUR

Size
10ug
Description
  • Gene name: FGG
  • Gene ID: 2266
  • Accession number: BC007044
  • Vector: pUC
For research use only.
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1314
  • Sequence: atgagttggtccttgcacccccggaatttaattctctacttctatgctcttttatttctctcttcaacatgtgtagcatatgttgctaccagagacaactgctgcatcttagatgaaagattcggtagttattgtccaactacctgtggcattgcagatttcctgtctacttatcaaaccaaagtagacaaggatctacagtctttggaagacatcttacatcaagttgaaaacaaaacatcagaagtcaaacagctgataaaagcaatccaactcacttataatcctgatgaatcatcaaaaccaaatatgatagacgctgctactttgaagtccaggaaaatgttagaagaaattatgaaatatgaagcatcgattttaacacatgactcaagtattcgatatttgcaggaaatatataattcaaataatcaaaagattgttaacctgaaagagaaggtagcccagcttgaagcacagtgccaggaaccttgcaaagacacggtgcaaatccatgatatcactgggaaagattgtcaagacattgccaataagggagctaaacagagcgggctttactttattaaacctctgaaagctaaccagcaattcttagtctactgtgaaatcgatgggtctggaaatggatggactgtgtttcagaagagacttgatggcagtgtagatttcaagaaaaactggattcaatataaagaaggatttggacatctgtctcctactggcacaacagaattttggctgggaaatgagaagattcatttgataagcacacagtctgccatcccatatgcattaagagtggaactggaagactggaatggcagaaccagtactgcagactatgccatgttcaaggtgggacctgaagctgacaagtaccgcctaacatatgcctacttcgctggtggggatgctggagatgcctttgatggctttgattttggcgatgatcctagtgacaagtttttcacatcccataatggcatgcagttcagtacctgggacaatgacaatgataagtttgaaggcaactgtgctgaacaggatggatctggttggtggatgaacaagtgtcacgctggccatctcaatggagtttattaccaaggtggcacttactcaaaagcatctactcctaatggttatgataatggcattatttgggccacttggaaaacccggtggtattccatgaagaaaaccactatgaagataatcccattcaacagactcacaattggagaaggacagcaacaccacctggggggagccaaacaggctggagacgtttaa
Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.

* The price of the product is approximate, please contact us for price confirmation

Related Products:

Human Fibrinogen Gamma (FGg) ELISA Kit
DLR-FGg-Hu-48T
DL Develop 48T
Human Fibrinogen Gamma (FGg) ELISA Kit
DLR-FGg-Hu-96T
DL Develop 96T
PCGF2 cloning plasmid
CSB-CL017606HU-10ug
Cusabio 10ug
PCMT1 cloning plasmid
CSB-CL017618HU-10ug
Cusabio 10ug
PEX10 cloning plasmid
CSB-CL017794HU2-10ug
Cusabio 10ug

Do you have a question? Do you want to order?
Contact us.