Image of ETFA cloning plasmid

ETFA cloning plasmid

Supplier Cusabio · Catalog number: CSB-CL007844HU-10ug

Price

233.00 EUR

Size
10ug
Description
  • Gene name: ETFA
  • Gene ID: 2108
  • Accession number: BC015526
  • Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
For research use only.
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atgttccgagcggcggctccggggcagctccggcgggcggcctcattgctacgatttcagagtaccctggtaatagctgagcatgcaaatgattccctagcacccattactttaaataccattactgcagccacacgccttggaggtgaagtgtcctgcttagtagctggaaccaaatgtgacaaggtggcacaagatctctgtaaagtagcaggcatagcaaaagttctggtggctcagcatgatgtgtacaaaggcctacttccagaggaactgacaccattgattttggcaactcagaagcagttcaattacacacacatctgtgctggagcatctgccttcggaaagaaccttttgcccagagtagcagccaaacttgaggttgccccgatttctgacatcattgcaatcaagtcacctgacacatttgtgagaactatttatgcaggaaatgctctatgtacagtgaagtgtgatgagaaagtgaaagtgttttctgtccgtggaacatcctttgatgctgcagcaacaagtggcggtagtgccagttcagaaaaggcatcaagtacttcaccagtggaaatatcagagtggcttgaccagaaattaacaaaaagtgatcgaccagagctaacaggtgccaaagtggtggtatctggtggtcgaggcttgaagagtggagagaactttaagttgttatatgacttggcagatcaactacatgctgcagttggtgcttcccgtgctgctgttgatgctggctttgttcccaatgacatgcaagttggacagacgggaaaaatagtagcaccagaactttatattgctgttggaatatctggagccatccaacatttagctgggatgaaagacagcaagacaattgtggcaattaataaagacccagaagctccaattttccaagtggcagattatggaatagttgcagatttatttaaggtagttcctgaaatgactgagatattgaagaaaaaatga
Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.

* The price of the product is approximate, please contact us for price confirmation

Related Products:

Rat ETFA shRNA Plasmid
20-abx989071
Abbexa
  • 150 µg
  • 300 µg
Mouse ETFA shRNA Plasmid
20-abx980108
Abbexa
  • 150 µg
  • 300 µg
PCDHGB4 cloning plasmid
CSB-CL890762HU-10ug
Cusabio 10ug
PCDHA6 cloning plasmid
CSB-CL890763HU-10ug
Cusabio 10ug
CDC23 cloning plasmid
CSB-CL891530HU-10ug
Cusabio 10ug

Do you have a question? Do you want to order?
Contact us.